rs473961 chr11:75376095 A>G
- Sequence
gagaatcgcttgaacctgggaggc[A/G]gaggttgcagtgagccaagattgc
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.61 | -0.26 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.78 | 0.16 | 1.52 |
Items per page:
1 – 2 of 2