rs474226 chr1:201721515 G>C
- Sequence
aacatgcaaacctgagctgtcgtt[G/C]ctcagcctcctgttggtcttctca
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.72 | 0.05 | 2.04 | |||
| HEK293T (embryonic kidney) | 0.14 | 0.91 | 1.33 |
Items per page:
1 – 2 of 2