rs4747012 chr10:70357832 T>C
- Sequence
caaacgtatacatacaaaagggaa[T/C]agaaacagcagccaggatgacact
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -3.20 | 1.90 | 2.50 | 3.65 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood