rs475188 chr19:52646714 C>A
- Sequence
tctaagaaactggatacatccccc[C/A]caactacacatggttaagaaaaca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.53 | 0.20 | 2.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, chronic kidney disease, hip bone mineral density (bmd), lp-pla2 mass, schizophrenia, simpson-angus scale, spine bone mineral density (bmd), transmission distortion
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Prostate, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood