rs475323 chr7:6050969 A>G
- Sequence
gactagtcagtaaagtactaagcc[A/G]tttctaaaaaaagggcaaacaaaa
- ASB in cell types
- HepG2 (hepatoblastoma) ZR-75-1 (invasive ductal carcinoma)
- ASB for transcription factors
- FOXA2_HUMAN FOXA3_HUMAN FOXA1_HUMAN SKI_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | -0.92 | 0.71 | 1.33 | n/a | No Hit | |||
| FOXA3_HUMAN | -2.67 | 2.44 | 1.50 | n/a | No Hit | |||
| FOXA1_HUMAN | -0.01 | 1.00 | 1.58 | n/a | No Hit | |||
| SKI_HUMAN | -2.22 | 2.04 | 1.33 | n/a | n/a | |||
| FOXP1_HUMAN | -1.19 | 1.05 | 1.42 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, docetaxel response in lymphoblastoid cell lines, fasting blood glucose, resistance to kuru in aged women despite likely exposure, total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Colon_Transverse, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid