rs4753852 chr11:108895979 A>C
- Sequence
acttcctctttgtggcaattcact[A/C]tttaccaagcaggactggaatgtt
- ASB in cell types
- SK-N-SH (neuroblastoma) GM12878 (female B-cells) HT29 (colon adenocarcinoma)
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | -1.43 | 1.51 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1