rs475505 chr6:150991682 A>G
- Sequence
atgtgactgtagctgacaagtgtc[A/G]gcagattgtgggcatagtttagag
- ASB in cell types
- neural cell
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | 1.50 | -1.37 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1