rs476059 chr9:33458579 C>T
- Sequence
cctctggtttgaaacacccttctt[C/T]ttggtcctccttggttccctgggg
- ASB in cell types
- monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.36 | -3.32 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, ldl cholesterol, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins, triglycerides
GTEx eQTL Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid