rs4760682 chr12:48118502 C>A
- Sequence
ccagaatgtgcagaggtagagata[C/A]aagtaagcaagaggaagagggcag
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- SOX6_HUMAN NCOR1_HUMAN TAL1_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SOX6_HUMAN | n/a | 2.90 | 2.00 | n/a | n/a | |||
| NCOR1_HUMAN | -2.08 | 2.13 | 2.00 | n/a | n/a | |||
| TAL1_HUMAN | -1.79 | 2.01 | 2.00 | n/a | No Hit | |||
| REQU_HUMAN | -1.02 | 1.80 | 2.00 | n/a | n/a | |||
| GATA1_HUMAN | -1.09 | 1.62 | 2.00 | 3.66 | Concordant |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood