rs4761423 chr12:76392569 G>A
- Sequence
tgaaacattaccaactcagcggca[G/A]tatctacttactggaagttatcac
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.19 | 0.57 | 2.04 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, coronary artery disease (cad), combined control dataset, hdl cholesterol, triglycerides change with statins
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Heart_Atrial_Appendage, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood