rs476200 chr11:114439747 T>C
- Sequence
cgtggaaccgaggagtcgagcccg[T/C]cctgggagagcgttgggggtctgg
- ASB in cell types
- GM12878 (female B-cells) foreskin keratinocyte HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.60 | 0.10 | 1.27 | |||
| foreskin keratinocyte | 1.63 | n/a | 2.50 | |||
| HEK293 (embryonic kidney) | 0.49 | 0.42 | 1.29 |
Items per page:
1 – 3 of 3