rs4762148 chr12:96427473 A>T
- Sequence
ggggcagcaaatgtctcagccaga[A/T]tgctctcacatctggatcaggagc
- ASB in cell types
- HEK293 (embryonic kidney) upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.17 | 0.60 | 1.99 | |||
| upper lobe of left lung | 0.24 | 1.87 | 1.67 |
Items per page:
1 – 2 of 2