rs4764650 chr12:101727315 T>G
- Sequence
aaagttattcaaccactaagtaca[T/G]taggtactgatacttatctttcca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN FOXA1_HUMAN GATA3_HUMAN PRGR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.67 | -0.83 | 2.11 | n/a | No Hit | |||
| FOXA1_HUMAN | 1.90 | -1.45 | 2.25 | n/a | No Hit | |||
| GATA3_HUMAN | 1.60 | -1.68 | 2.25 | n/a | No Hit | |||
| PRGR_HUMAN | 1.75 | -0.64 | 2.00 | 2.50 | Discordant |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP birth weight, height, ldl cholesterol, ldl cholesterol change with statins, systolic blood pressure (sbp), total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid