rs4769165 chr13:21435947 A>G
- Sequence
ctaagggagcaatctcactgcaat[A/G]tagtcctggcttcagcaaccggca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.36 | 0.78 | 2.15 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Testis, Thyroid