rs4772076 chr13:98405583 A>C
- Sequence
tgagagctactaacctgacatcta[A/C]ctgaatgcctaagaaattgcaggg
- ASB in cell types
- pancreas neural cell
- ASB for transcription factors
- CTCF_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.16 | 0.93 | 1.40 | n/a | No Hit | |||
| SMC3_HUMAN | -1.03 | 1.33 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP asthma, hdl cholesterol, ldl cholesterol, parkinsons disease, premature ovarian failure, total cholesterol, total cholesterol change with statins