rs4772604 chr13:104107143 T>G
- Sequence
ccagcccaccttctgaagatgcag[T/G]ctctggcaggtggaatggctttga
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.60 | -0.58 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, late onset alzheimers disease, microalbuminuria, salmonella-induced pyroptosis, urinary albumin-to-creatinine ratio