rs4777417 chr15:71610497 A>G
- Sequence
cctgtggcaacaggatggaactta[A/G]caaaggggactgccctttcagaaa
- ASB in cell types
- T47D (invasive ductal carcinoma) HEK293 (embryonic kidney)
- ASB for transcription factors
- ANDR_HUMAN PRGR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.52 | -0.96 | 1.38 | n/a | No Hit | |||
| PRGR_HUMAN | 1.73 | -1.04 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, obesity with early age of onset (age >2), simpson-angus scale, tardive dyskinesia