rs477955 chr2:45643763 A>G
- Sequence
tggtccggggctgagcggggcacc[A/G]cagggagcggagacagcggaggcg
- ASB in cell types
- K562 (myelogenous leukemia) A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.01 | 0.81 | 1.98 | |||
| A549 (lung carcinoma) | 0.74 | 0.29 | 1.16 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.99 | 0.40 | 1.37 | |||
| GM12878 (female B-cells) | 0.56 | 0.40 | 1.32 | |||
| lymphoblastoid cells | 1.69 | -1.48 | 1.33 |
Items per page:
1 – 5 of 7