rs478000 chr1:109643511 C>A
- Sequence
gaggtgcacggttggccaccaggg[C/A]gcgctgctggactctccccagaaa
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | 0.38 | 0.73 | 1.53 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 0.37 | 0.65 | 1.50 |
Items per page:
1 – 2 of 2