rs478093 chr1:119712503 A>G
- Sequence
ggcgccccagcgccttagcgcgca[A/G]ttgttctggcagcctcgcgccgcc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.31 | 0.54 | 1.35 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diastolic blood pressure (dbp), hdl cholesterol, ldl cholesterol, metabolites in glutathione and glycine biosynthesis pathways, neuroticism, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid