rs4782573 chr16:83953647 G>A
- Sequence
cagtcccagcgtaccctgggccat[G/A]tgaccgccgctcctagcaggaaag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- USF1_HUMAN ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| USF1_HUMAN | 2.34 | -3.21 | 1.50 | -5.69 | Concordant | |||
| ZFX_HUMAN | -1.06 | 1.56 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Hypothalamus, Cells_EBV-transformed_lymphocytes, Liver, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood