rs478442 chr2:21176344 G>T
- Sequence
gcgggtaatgctgagtgatggaat[G/T]ttagagccaagggaaatgtgttag
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.68 | -0.24 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI age-related disease endophenotypes, age-related diseases, mortality and associated endophenotypes
GRASP hdl cholesterol, ldl cholesterol, ldl cholesterol change with statins, ldl cholesterol in serum, lp-pla2 mass, parkinsons disease, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg