rs479848 chr20:951870 T>C
- Sequence
ggccgcccagctgtgagcggtgcg[T/C]gtattctctccagccttgaattca
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- HIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF1A_HUMAN | 2.06 | -1.64 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hypertension (early onset hypertension), triglycerides change with statins