rs4798617 chr18:839546 A>T
- Sequence
gtggtcaaaactggcagtgccgtt[A/T]gcgggctcagcgggacgtgagaac
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.33 | 0.70 | 1.28 | |||
| foreskin keratinocyte | n/a | 0.29 | 2.50 |
Items per page:
1 – 2 of 2