rs480075 chr1:186487204 A>G
- Sequence
gggactttggctctcatagaacag[A/G]tatcagaatgttacgtccatattc
- ASB in cell types
- coronary artery smooth muscle
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| coronary artery smooth muscle | 1.25 | -0.60 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, apoa2 (apolipoprotein aii), birth weight, hdl cholesterol, height, lp-pla2 activity, total cholesterol, type 2 diabetes