rs4802723 chr19:50669529 A>G
- Sequence
aaggtgaggaaactgaaattcagc[A/G]gaacttcctccccacgccaggagg
- ASB in cell types
- HeLa Kyoto (cervical adenocarcinoma) A549 (lung carcinoma) erythroid progenitors MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa Kyoto (cervical adenocarcinoma) | -0.58 | 1.69 | 2.00 | |||
| A549 (lung carcinoma) | 0.44 | 0.51 | 1.41 | |||
| erythroid progenitors | 1.34 | n/a | 2.50 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.79 | 1.00 | 2.39 |
Items per page:
1 – 4 of 4