rs4807087 chr19:6516183 G>A
- Sequence
ggaagggcctggagcggacagcag[G/A]ggaagtgggcggggcctggggaga
- ASB in cell types
- K562 (myelogenous leukemia) periferal blood macrophages H929 (plasma cell myeloma) HL-60 (acute myeloid leukemia)
- ASB for transcription factors
- GABPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABPA_HUMAN | -1.54 | 1.54 | 2.00 | 2.17 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, microalbuminuria, obesity with early age of onset (age >2), rheumatoid arthritis, schizophrenia