rs4808604 chr19:17225364 A>G
- Sequence
cagctatttgggaggctgaggtgg[A/G]aggatcaattgaggctaggaagga
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.54 | -0.07 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.48 | -0.16 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Thyroid, Whole_Blood