Attention! You are using release Soos. You can switch to the latest ADASTRA version: adastra.autosome.org

rs4809324 chr20:63686867 T>C

Sequence
agattccaagggcctggaatctgt[T/C]tgttccattgacctctgatgtcac
ASB for transcription factors
ANDR_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (T) ASB
color scale alt
-log10 FDR of Alt (C) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
ANDR_HUMAN 1.26 -0.80 0.051.00 1.50 n/a No Hit
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI glioma (high-grade)
GRASP adiponectin levels coronary artery disease (cad) glioma (glioblastoma) glioma (high-grade glioma) high-grade glioma obesity with early age of onset (age >2) premature ovarian failure spine bone mineral density (bmd)
PheWAS abnormal findings on radiological examination intrathoracic organs abnormal weight gain adverse drug events and drug allergies adverse effects of cardiac rhythm regulators allergic rhinitis aphakia and other disorders of lens aseptic necrosis of bone asthma with exacerbation benign neoplasm of respiratory and intrathoracic organs bronchitis bundle branch block chronic lymphocytic thyroiditis chronic pharyngitis and nasopharyngitis chronic sinusitis decubitus ulcer deficiency of humoral immunity deviated nasal septum diseases of the tongue disorders of external ear dupuytrens disease failure to thrive fibroadenosis of breast fluid overload fracture of hand or wrist fracture of unspecified bones frequency of urination and polyuria gastritis and duodenitis generalized hyperhidrosis hypertensive chronic kidney disease intestinal infection intestinal obstruction without mention of hernia lack of normal physiological development left bundle branch block lesions of stomach and duodenum liver abscess and sequelae of chronic liver disease macular degeneration, wet magnesium metabolism disorder nasal polyps nervous system congenital anomalies open wound of ear open wound of hand except finger(s) osteochondropathies other congenital anomalies other dermatoses other intestinal obstruction other specified diseases of the salivary glands other specified gastritis polymyalgia rheumatica polyp of corpus uteri polyp of female genital organs postlaminectomy syndrome postmenopausal bleeding primary thrombocytopenia prolapse of vaginal walls retinal edema and hypertensive retinopathy seborheic dermatitis symptoms involving nervous and musculoskeletal systems symptoms/disorders of the urinary system urinary incontinence
GTEx eQTL Adipose_Subcutaneous Artery_Tibial Esophagus_Mucosa Nerve_Tibial Pancreas Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Thyroid Whole_Blood

Download