rs4811073 chr20:50483272 C>T
- Sequence
aatacaaaaattagccgggcgtga[C/T]ggtgggtgcctgtaatcccaggta
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.15 | 0.94 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.02 | -0.55 | 4.22 | |||
| GM12878 (female B-cells) | -1.22 | 1.64 | 1.50 |
Items per page:
1 – 3 of 3