rs4812860 chr20:44747723 G>A
- Sequence
ccaccaccctctgtggtctagtcc[G/A]ctgaagccagccttgcagagagcc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.10 | -0.08 | 2.13 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Thyroid