rs4813865 chr20:8601756 T>G
- Sequence
cctctgagcaagttttctttgcac[T/G]tgagtaaagcagatggattaatgt
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- ARNT_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARNT_HUMAN | -1.78 | 1.99 | 1.00 | 6.25 | Concordant | |||
| IKZF1_HUMAN | -0.79 | 1.18 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP celiac disease, college completion, diastolic blood pressure (dbp), hypertension (early onset hypertension), triglycerides, variant creutzfeldt-jakob disease