rs481571 chr1:10430824 G>A
- Sequence
gcgtgcgggcgccggggtccggcg[G/A]cgagaggccaccttctggccttgc
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) adrenal gland cranial neural crest cells
- ASB for transcription factors
- CTCF_HUMAN AP2A_HUMAN SP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.69 | 0.46 | 1.33 | 0.89 | Weak Discordant | |||
| AP2A_HUMAN | 1.71 | -1.56 | 2.00 | n/a | No Hit | |||
| SP2_HUMAN | 1.92 | -1.77 | 2.00 | -0.88 | Weak Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood