rs4815998 chr20:816179 C>T
- Sequence
gaatggattaggggctgacagtgc[C/T]gctgcagttactcaaaggagccac
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte A549 (lung carcinoma) epidermal keratinocytes
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.28 | 1.22 | 1.65 | n/a | n/a |
Items per page:
1 – 1 of 1