rs4819654 chr22:18000622 A>G
- Sequence
cggttccgtgtagggctcctcaag[A/G]tggtttcttagctgggaatttccc
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.82 | -0.14 | 1.94 | |||
| GM12878 (female B-cells) | 0.42 | 0.54 | 1.23 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid