rs482387 chr1:28846112 G>A
- Sequence
tcctttctggctcactacactgtc[G/A]tcacatgtgatttctgaccattcc
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.53 | -0.23 | 2.00 | |||
| HEK293T (embryonic kidney) | 0.06 | 0.72 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), microalbuminuria, obesity with early age of onset (age >2), serum creatinine, systolic blood pressure (sbp), total cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood