rs4829748 chrX:132975371 C>G
- Sequence
caaccatttctcaatggaaattgc[C/G]caggtagttaccataaataagaaa
- ASB in cell types
- neural progenitors HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural progenitors | -3.22 | 2.72 | 1.50 | |||
| HEK293 (embryonic kidney) | 0.45 | -0.27 | 2.04 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Coronary, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood