rs4835355 chr4:146916635 T>G
- Sequence
tataaaaaggtctttaaatttaca[T/G]gatttccaatgagttgactggtct
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) OCI-LY1 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.23 | 0.93 | 2.02 | |||
| GM12878 (female B-cells) | 0.70 | 0.33 | 1.30 | |||
| OCI-LY1 (diffuse large B-cell lymphoma) | 1.59 | -1.32 | 1.00 |
Items per page:
1 – 3 of 3