rs483808 chr19:7892596 C>T
- Sequence
tggatggccggaaccaaaacagga[C/T]gtgagggtccctggtgctgggtcc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- ETV5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETV5_HUMAN | -2.42 | 2.47 | 1.33 | 2.05 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP cystatin c in serum, fasting insulin, hdl cholesterol, height, homa-ir, systolic blood pressure (sbp), triglycerides, waist hip ratio
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Esophagus_Mucosa, Heart_Atrial_Appendage, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid