rs4842838 chr15:83913372 G>T
- Sequence
ttcaccccttgcacagcaacatgc[G/T]tgggaggtatttgaacctttgctt
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 2.01 | -0.00 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI height, waist circumference adjusted for bmi (joint analysis main effects and physical activity interaction), waist circumference adjusted for bmi in active individuals, waist circumference adjusted for body mass index
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, age at menarche, asthma, femur length, hdl cholesterol, height, height (adolescents), height (adults), height (females), hip axis length, obesity with early age of onset (age >2), schizophrenia, tetrology of fallot, triglycerides
PheWAS abnormal findings on examination of urine, althetes foot, angina pectoris, arthralgia/ankylosis of temporomandibular joint, arthropathy nos, atherosclerosis of native arteries of the extremities with ulceration or gangrene, atherosclerosis of renal artery, breast disorder nos, cancer of bone & connective tissue, cancer of connective tissue, cancer of other female genital organs, cancer, suspected or other, cellulitis and abscess of hand/fingers, cerebral ischemia, cerebrovascular disease, cervical cancer, cervicitis and endocervicitis, choroidal degenerations, chronic ischemic heart disease, chronic ulcer of skin, convulsions, cyst and pseudocyst of pancreas, deep vein thrombosis, delirium due to conditions classified elsewhere, diffuse diseases of connective tissue, diseases of pulp and periapical tissues, disorders of lipoid metabolism, encounter for long-term use of aspirin, epilepsy, eye infection, viral, fractur of unspecified part of femur, generalized convulsive epilepsy, gingival and periodontal diseases, hallux valgus (bunion), hematuria, hypercholesterolemia, hyperlipidemia, large cell lymphoma, lipoid metabolism disorder nos, lupus erythematosus, malignant neoplasm of ovary, malignant neoplasm, other, megaloblastic anemia, myasthenia gravis, myoneural disorders, nervous system congenital anomalies, nodular lymphoma, nontoxic multinodular goiter, other disorders of bladder, other endocrine disorders, other signs and symptoms in breast, other specified gastritis, other symptoms involving abdomen and pelvis, ovarian cancer, pelvic peritoneal adhesions, female (postoperative) (postinfection), periapical abscess, pericarditis, peripheral angiopathy in diseases classified elsewhere, pernicious anemia, pilonidal cyst, polyp of corpus uteri, polyp of female genital organs, pulmonary embolism and infarction, sinoatrial node dysfunction, systemic lupus erythematosus, transient cerebral ischemia, type 2 diabetic peripheral circulatory disorders, uterine leiomyoma
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood