rs4845712 chr1:155070960 G>C
- Sequence
ccggctcccagcggccccaggcca[G/C]cctccttttcgcagaaccaggcgg
- ASB in cell types
- HEK293 (embryonic kidney) PANC1 (pancreatic ductal adenocarcinoma) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.17 | 0.85 | 2.01 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 1.98 | -1.66 | 2.00 | |||
| HEK293T (embryonic kidney) | 0.68 | 0.02 | 1.26 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Hippocampus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood