rs484677 chr1:27077270 T>C
- Sequence
gaccagtaattccacttgcaggta[T/C]ttacctgcaatgaaatgaaatgaa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.23 | 0.54 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, arthritis including non-rheumatoid, hdl cholesterol, height, hypertension (early onset hypertension), longstanding arthritis, parkinsons disease, primary rhegmatogenous retinal detachment, rheumatoid arthritis, tetrology of fallot, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid