rs4852868 chr2:69604504 C>T
- Sequence
gctcattgctaactcaccctctta[C/T]cttcttgccccaccatagtatcag
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ARI1B_HUMAN EMSY_HUMAN RING2_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | n/a | 3.68 | 2.00 | n/a | n/a | |||
| EMSY_HUMAN | n/a | 2.44 | 2.00 | n/a | n/a | |||
| RING2_HUMAN | n/a | 2.69 | 2.00 | n/a | n/a | |||
| REQU_HUMAN | n/a | 2.65 | 2.00 | n/a | n/a | |||
| KDM1A_HUMAN | -2.88 | 2.21 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 9
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, salmonella-induced pyroptosis
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood