rs4854439 chr2:68673118 A>T
- Sequence
gatgctttcctcaagttgcctggt[A/T]attcttgactcttccttcatattt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- RFX5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX5_HUMAN | 2.07 | -2.11 | 1.33 | -2.31 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
