rs485789 chr3:160012361 G>T
- Sequence
gacttatttttcaactctctctca[G/T]tttcagtctttcatgttatcaaac
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 1.41 | n/a | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, age at death with kuru exposure, body mass index (bmi), coronary artery disease (cad), hypertension (early onset hypertension), primary biliary cirrhosis, rheumatoid arthritis
GTEx eQTL Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Mucosa, Whole_Blood