rs4862648 chr4:186150167 T>C
- Sequence
gcctctgaactgcttttgtctgtg[T/C]gagcctgggattctggctgggcga
- ASB in cell types
- tibial nerve GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| tibial nerve | 2.00 | n/a | 1.33 | |||
| GM12878 (female B-cells) | 0.34 | 0.79 | 1.30 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Spleen, Thyroid