rs4866041 chr5:19877346 T>C
- Sequence
ttacagtatgctttgaattttaaa[T/C]gtgggtatgctttgattgagcaat
- ASB in cell types
- SUM159PT (pleiomorphic breast carcinoma)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -0.63 | 1.33 | 1.87 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, total cholesterol, triglycerides, years of education