rs4867313 chr5:31144534 G>A
- Sequence
gaaaaaacatcctctctcattgcc[G/A]ttacagagagagacgaaatcatat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- BMI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BMI1_HUMAN | -0.62 | 2.02 | 1.67 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), infant head circumference, ldl cholesterol change with statins, partial epilepsy, total cholesterol change with statins