rs487611 chr11:116460272 G>C
- Sequence
cccccaaattcaatcagggaaaca[G/C]aggcattttcccaggaagactgga
- ASB in cell types
- SK-N-SH (neuroblastoma)
- ASB for transcription factors
- COE3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COE3_HUMAN | -3.19 | 2.49 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP mitral annular calcium, obesity with early age of onset (age >2), parkinsons disease, total cholesterol