rs488251 chr16:88906146 G>A
- Sequence
atccctgcacccccaagcagtgtg[G/A]ggagtctctggagctcccaccggc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.21 | 0.55 | 2.32 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), arthritis including non-rheumatoid, comorbid depressive syndrome and alcohol dependence, hip bone mineral density (bmd), hypertension (early onset hypertension), ldl cholesterol, schizophrenia, spine bone mineral density (bmd)
GTEx eQTL Artery_Aorta, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellum, Brain_Cortex, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood